What is 0.3% written as a decimal?

A 0.003

B 0.3

C 3

D 30

Answers

Answer 1
Move the decimal to the right two times.

0.3% => 0.003

A 0.003 is the answer.
Answer 2

Answer:

0.003%

Step-by-step explanation:

you have to multiply this number by 100 which makes 0.3%


Related Questions

how to creat an array with 141 divided by 3

Answers

The way to create is by of course dividing 141/3 and you'll get 47.

The points in the table lie on a line. Find the slope of the line.

Answers

Given two points (x₁,y₁) and (x₂,y₂) the slope of the line passes through these points will be:
m=(y₂-y₁)/(x₂-x₁)


We need only two points;
For example:
The points (2,2) and (7,4).
m=(4-2)/(7-2)=2/5

The slope would be 2/5.

I you choose other points, for example (-3.0) and (12,6) the result would be the same.
m=(6-0)(12+3)=6/15=2/5

Answer: the slope would be 2/5

Answer: [tex]\dfrac{2}{5}[/tex]

Step-by-step explanation:

We know that the slope of a line is given by :-

[tex]\text{Slope}=\dfrac{\text{Change in y}}{\text{Change in x}}[/tex]

From the given table , we have

[tex]\text{Slope}=\dfrac{2-0}{\text{2-(-3)}}\\\\\Rightarrow\ \text{Slope}=\dfrac{2}{2+3}\\\\\Rightarrow\ \text{Slope}=\dfrac{2}{5}[/tex]

Therefore, the slope of the line= [tex]\dfrac{2}{5}[/tex]

How do you write 3.25 in simplest form

Answers

3.25 as a fraction is 325/100 I believe.
3.25 would be 3 1/4 because,

Step 1: You would rewrite the decimal number as a fraction with 1 in the denominator. So, 3.25 = 3.24/1

Step 2: Multiply it by 1 to eliminate 2 decimals places, so multiply the top and bottom by 10^2 = 100
3.25/1 x 100/100 = 325/100
Step 3: Now you find the greatest common factor, also known as GCF, of 325 and 100 if it exits then you reduce the fraction by dividing both numerator and denominator by it. GCF = 25
3.25/100 divided by 25/25 = 13/4
Now you would simplify it to make a proper fraction getting your answer
3 1/4
Does that make sense?

what does 693 / 74 equal

Answers

the answer is 9.37 when it is rounded up.
if i helped can i get a brainiest answer please
mark me as a brainliest
3.64 is when it is rounded up.
HOPE THIS HELPS!!!!!!! 

How can i tell if it's discrete or continuous?

Answers

If it is continuous you will see a straight line if it is discrete then you will not see a straight line it will be zigzag or something like that
Final answer:

Discrete variables are counted and only take on certain numerical values, while continuous variables are measured and their probability is calculated over a range of values. The difference between them is reflected in their probability distributions: discrete variables create a probability distribution function (PDF), continuous variables form a probability density function (pdf).

Explanation:

Discrete and continuous variables are defined based on how they are measured. Discrete variables are counted, represented by certain numerical values. For instance, the number of books in a backpack or the number of miles you drive to work could be discrete variables.

Continuous variables, on the other hand, are measured. Examples include the distance you drive to work or the weight of a book. A characteristic of continuous variables is that the probability of the variable taking on a single, specific value is zero (P(x = c) = 0), therefore probability is calculated over a range of values.

The distinction between discrete and continuous variables is often highlighted by their probability distribution. Discrete variables create a probability distribution function (PDF), such as counts of chosen values for x. Continuous variables form a probability density function (pdf), which is represented as a curve in the graph, with total probability under the curve equaling 1.

Learn more about Discrete vs Continuous Variables here:

https://brainly.com/question/30764580

#SPJ12

There are 40 nickels in every standard coin roll, what is the constant of proportionality

Answers

The constant of proportionality is 40 nickels/standard coins.
The constant is 1 coin roll for every 40 nickels

Twenty-four students brought their permission slips to attend the class field trip to the local art museum. If this represented eight tenths of the class, how many students are in the class? Use a bar diagram to solve arithmetically. Then use an equation to solve algebraically.

Answers

If 24 students went on a field trip, and 24 students represented eight tenths of the class, then [tex]24 = \frac{8}{10}x[/tex].
First, multiply by 10 on both sides.
240 = 8x
Divide by 8 on both sides.
x = 30.

The class has 30 students in all.
This is, however, only the equation way to solve. 

The Skubic family and the Shaw family went on a safari tour in which they drove their own vehicles through the park to view the animals. The cost of the tour was $5.25 per vehicle plus an additional amount for each person in the vehicle. The Skubic family had 7 people in their vehicle and paid $22.75.

Answers

The total cost for the safari tour for the Shaw family is $12.75 with a vehicle cost of $5.25 and an additional amount per head of $2.5.

let us say the additional amount for each person = Z

it is given that

cost of the tour per vehicle = $5.25

number of family members in Skubic family = 7

number of family members in Shaw family = 3

total cost = $22.75

what will be the total cost for each family?

the total cost will be the sum of the additional amount for all and vehicle cost.

Total cost for Skubic family

7z + 5.25 = 22.75(given)

7z= 17.5

z=$2.5

total cost for Shaw family = 3z+5.25 = 3*2.5+5.25 = $12.75

therefore, the total cost for the Shaw family is $12.75

to get more about such word problems refer to the link,

https://brainly.com/question/26142862

Marty has 6 more pigs than Jen has.After he gives 10 pigs to Jen,how many more pigs will Jen have than Marty?

Answers

4
 is the answer.


:D
jen will have 4 mor epigs than mrty
Final answer:

To find out how many more pigs Jen will have than Marty after Marty gives her 10 pigs, subtract the number of pigs Marty has after giving away 10 from the number of pigs Jen has.

Explanation:

To find out how many more pigs Jen will have than Marty after he gives her 10 pigs, we need to determine the initial number of pigs each of them has. Let's assume Jen has x pigs. Since Marty has 6 more pigs, he has x + 6 pigs. After giving 10 pigs to Jen, Marty will have x + 6 - 10 = x - 4 pigs, and Jen will have x + 10 pigs. Therefore, Jen will have (x + 10) - (x - 4) = x + 10 - x + 4 = 14 more pigs than Marty.

Learn more about pigs here:

https://brainly.com/question/38135527

#SPJ2

Which set of side lengths can be used to form a right triangle?
A: 14,48,50
B: 10,24,28
C: 30,40,60
D: 14,50,60

Answers

Use the Pythagorean Theorem to answer this question.

[tex]a^2 +b^2 = c^2 [/tex]
with c being the hypotenuse. 

Only A would work. 
A: 14,48,50
Using the Pythagorean Theorm, 14^2 + 48^2 = 50^2

ok sorry for the other picture for my question here is a better one best answer 7,8,9 and 10 . THxxxxxx!!!!

Answers

You can write those decimals in two other forms: fraction form and word form.

7. 0.326
Word form: Three hundred twenty six thousandths.
Fraction form: 326/1000 or 163/500.

8. 8.517
Word form: Eight and five hundred seventeen thousandths.
Fraction form: 8517/1000 = 8 517/1000

9. 0.924
Word form: Nine hundred twenty-four thousandths.
Fraction form: 924/1000

10. 1.075
Word form: One and seventy five thousandths.
Fraction form: 1075/1000 or 43/40 = 1 3/40

the width of a singles tennis court is 75% of the width of a doubles Court a doubles court is 36 feet wide how wide is a singles Court

Answers

i think you just simply need to multiply them.

The width of a singles tennis court is :

75 %  x 36 feet 

= 75 /100 x 36 feet

= 3/4 x 36 feet

= 27 feet

Hope this helps

The width of a singles tennis court, which is 75% of a doubles court, is calculated to be 27 feet by multiplying the doubles court's width (36 feet) by 0.75.

To find the width of a singles tennis court when given that it is 75% of the width of a doubles court, which is 36 feet wide, we multiply the width of the doubles court by 0.75 (75%). Here is the calculation:

Width of doubles court = 36 feet

Width of singles court = 36 feet × 0.75

Width of singles court = 27 feet

Therefore, the width of a singles tennis court is 27 feet.

If max eats 15 cookies in 2 hours and 30 minutes how many cookies would she eat in 4 hours

Answers

we know that max eats 15 cookies in 2.5 hours

that mean he eats :
15/2.5   = 6 cookies in an hour

The amount of cookies that he eats in 4 hours would be :
6 x 4 = 24 cookies

Hope this helps
60 cookies
She eats 15 cookies in 90 min(hour and a half) then she eats 40 cookies in 240 min


Simplify:

3(3t – 2) – 2(t + 1)

Answers

I hope this helps you



3.3t-2.4-2.t-2.1



9t-8-2t-2


7t-10
First distribute 
6t - 6 -2t - 2

Then simplify
4t - 8

Then divide by 4 to find what the variable is equal to:
t=-2

What is 5 wholes plus 8/6 or 1 2/6

Answers

5 + 1 2/6 = 6 2/6 = 6 ⅓

i think it is 6 2/6 because 5+1+2/6=6 2/6

A construction company bought 9 tons of gravel and 0.8 tons of sand.hoq many tons of material did the comapany but in all

Answers

The company bought 9.8 tons.

math a scientist uses a submarine to study ocean life she begins at sea keve which is and elevation of 0 ft she travels straight down for 80 seconds at my a speed of 4.0 ft per second she travles directly up for 20 seconds at a speed if 3.4 ft per second write an integer that represent a the submarines location after 100 seconds period plz answer before 8pm

Answers

Use the formula rate x time = distance


(rate going down)(time going down) = distance going down
(4.0 ft/s)(80 s) = 320 ft

Similarly,
(3.4 ft/s)(20 s) = 68 ft

distance traveled downward + distance traveled upward = total distance or location

320 feet + 68 ft = 388 feet below sea level

An onion farmer is hiring workers to help harvest the onions. He knows that the number of days it will take to harvest the onions is a function of the number of workers he hires. Explain the use of the word "function" in this context.

Answers

a relationship between a set of inputs

Answer: The word "function" is used to describe that the number of days is dependent on the number of workers.

Number of days = f(number of workers).

Step-by-step explanation:

We know that the more the number of workers will be involved in the harvesting of onion, the lesser days it will take to complete.

Thus, the number of workers becomes the independent variable, which is the input, and the number of days becomes the dependent variable, which is the output.

Note: I have copied this off from a good lad that goes by "fahimmohammad47", but this answer is from a different source. I did change some stuff to make it have more sense.

shelby needs to water each of her 3 plants woth 200 milliliters of water. How many milliliters of water does she need?

Answers

the correct answer is 600 mL

A dime weighs about 1/12 ounce jody has 1 pound of dimes (16 ounces) about how many dimes does jody have

Answers

1/12 is what a dime weighs so that's means 12 dimes weighs 1 ounce so if 16 oz is one pound do 12x16 and you will get the answer

Jody has approximately 192 dimes in 1 pound, calculated by first determining that 1 ounce equates to 12 dimes and then multiplying by the total ounces in a pound.

To determine how many dimes Jody has in 1 pound (16 ounces), we'll use the given information that a dime weighs about 1/12 ounce. First, we find the total number of dimes in one ounce:

1 ounce / (1/12 ounce per dime) = 12 dimes.

Now, since there are 16 ounces in a pound, we multiply the number of dimes in one ounce by the total ounces:

12 dimes per ounce * 16 ounces = 192 dimes.

Therefore, Jody has approximately 192 dimes in 1 pound.

Write a real-world problem to represent 7x-18 < 32

Answers

there are seven students and have (x) amount of Pokemon cards, but a bully comes and takes 18. It is less then 32. ( I think its a less then sign)

what two square roots are used to estimate the square root of 67

Answers

it would be 8.185 since there aren't 2 numbers that evenly go into 67

The root of 64 and 81

the perimeter of the top of a desk is 54 inches if the length of the desk is 15 inches what is the width of the desk

Answers

54-15=39
if you want to check your answer you add 39+15=54

A certain shade of green paint is made from 5 parts yellow mixed with 3 parts of blue. If 2 cans of yellow are used, how many cans of blue should be used?

Answers

Green is 5y:3b

Question asked for 2y:xb

5/2 = 3/x

x = 6/5 = 1.2

ALSO

Find by how much the yellow changes.  Do this by doing final divided by initial.

2/5 = 0.4

Multiply this by the original blue
0/4 * 3 = 1.2

Brainest Answer is appreciated

Mr.Jessup , an airline pilot, flies 1,350 miles a day. How many miles will he fly in 8 days?

Answers

1,350 * 8 = 10,800 

He will travel 10,800 miles in 8 days.
1350*8=10800 I hope I helped! :)

Which figure is not a polygon? A. Figure A B. Figure B C. Figure C D. Figure D

Answers

Final answer:

A polygon is a closed figure with straight line segments that do not cross over each other. Without seeing the actual figures it's impossible to decide, but if any figure has curved lines, is not closed, or has segments that cross, it would not be a polygon.

Explanation:

To determine which figure is not a polygon, we first need to understand what a polygon is. A polygon is a closed figure with a finite number of straight line segments that are connected end to end to form a single shape. The segments should not cross over each other, and the figure must entirely enclose a space.

With this definition, we can examine the provided figures. If any of the figures have curved lines, open sides, or line segments that cross each other, then that figure would not be considered a polygon. Unfortunately, without the visual references of Figures A, B, C, and D, it is impossible to definitively answer which figure is not a polygon. If any figure has one of the aforementioned characteristics, then it would be the correct answer.

For example, if Figure B has curved edges, or if Figure C is not closed, then they would not be polygons. Similarly, if Figure D is a soccer ball with pentagons and hexagons, those shapes are polygons, but if the soccer ball itself is rendered as a three-dimensional spherical object in Figure D, it would not be a polygon.

Fourteen percent of the town's population are above the age of 65. if there are 320 residents over the age of 65,approximately what is the town's population?

Answers

So if 14% are over 65, and 320 residents are over 65, then we can say that 14% of the town is 320. Then, we can divide by 14 to find 1%, which is 22.857142857 Now we can multiply this by 100 to get 2285.7142857, which is the answer. To double check, you'd just find 14% of 2285.7142857 (multiply by 0.14) which is equal to 320. Because you can't have fractions of people, however, you'd have to round the answer up to 2286 people. Hope this helps!
14% of the towns population is 320. Let P denote the towns population.
14/100 * P =320
14P/100 = 320
14P = 32000
divide both sides by 14
P = 2285.71
the towns population is 2286

What is 3/6 times 2/9

Answers

2 is your answer because 9/18 and 4/18 multiplied by each other = 36/18, which is converted to 2.

Answer:

its 1/9 with a repeating decimal of 0.11111....

Step-by-step explanation:

A jet flies at an altitude of 52, 800 feet what is the height of the jet in miles

Answers

Easy. The answer is 10 miles

The jet flies at an altitude of 10 miles, which is the result of dividing the given altitude of 52,800 feet by the number of feet in a mile (5,280).

To find the height of the jet in miles, we need to convert the altitude from feet to miles. There are 5,280 feet in a mile. So we will divide the jet's altitude in feet by the number of feet in a mile to get the altitude in miles.

Altitude in miles = Altitude in feet \/ Number of feet in a mile

Altitude in miles = 52,800 feet \/ 5,280 feet per mile

Altitude in miles = 10 miles

Therefore, the jet flies at an altitude of 10 miles.

An furniture salesperson sells a couch for $1,560. She receives a 2.75% commission on the sale of the couch. How much did she earn on the sale? Round your answer to the nearest cent.
Please Help!!!

Answers

$42.90 ($43)
Just multiply and move the decimal twice to the left.
Other Questions
Given the ip address 192.168.112.0. each network requires between 35 and 60 hosts. what is the broadcast address of the first available subnet? 30 POINTS DONT ANSWER IF YOU DONT KNOW THE ANSWER FOR SUREIn the gene TATTCATTGTTATGATTTATTCG, CATTGTTA encodes for pepsin, a digestive enzyme. The rest of the sequence doesnt code for any protein. Which sequence contains a mutation that will affect the formation of pepsin?A. TATTCATTCATTATGATTTATTCGB. TATTCATTGTTATGACTTTATTCGC. TATTCATTGTTATGATTTATTGGCGD. TATTCATTGTTATGATATTCGE. TGCATTCATTGTTATGATTTATTCG A box is given a push so that it slides across the floor. How far will it go, given that the coefficient of kinetic friction is 0.15 and the push imparts an initial speed of 3.5m/s? When was the u.s. constitution written? what is bulimia? can someone explain it to me. Which items describe people's interactions with their environment?Technology does not affect the earth's environment.People adapt to their environment.People adapt their environment.Population growth and the environment are unrelated.Changes to the earth's environment rarely matter.Changes to the earth's environment can be harmful.Changes to the earth's environment can be beneficial. Choose the sentence that has the correct form of the verb ser. Ellas es muy inteligentes. Clara no es cubana. Nosotros son amigos. Yo eres serio. A rate that describes how much smaller or larger the scale drawing is than the real object Write 6% as a decimal. There are two main functions for polysaccharides in living things. Discuss these two functions, and how the structures of polysaccharide molecules support these functions.Now I know that all polysaccharides are made up of the same monomer, glucose. Is this question essentially asking me the use of glucose throughout different organisms? Which of the following represents the graph of f(x) = 2x + 2? algebra help?write a function rule for the area of a triangle with a base of 3 cm greater than 5 times its height. what is the area of a triangle when its height is 6 cm? 6 letter word: a stack of thylakoids in a chloroplast Explain how the powers of the Supreme Court and federal law were extended by significant court cases during the period Algae uses all the energy in sunlight to perform photosynthesis.true or false what is 2 1/2 divided by 1/3 The ratio of the number of red marbles to the number of green marbles in a bag is 2:3. The ratio of the number of green marble to the number of blue marbles is 9:4 There are 76 marbles in the bag. a) Find the number of red marbles in the bag.b) Find the number of green marbles in the bag.C) Find the number of blue marbles in the bag///I already did a and b can you guys help me with c/// Endorphins can help reduce stress and are natural painkillers.TrueFalsei think its true? What was the purpose of having a cabinet?to use people outside of politics for adviceto assist the president in making decisionsto tell the president what to do The price of an item has been reduced by 70% . The original price was $60 . What is the price of the item now? Steam Workshop Downloader